Skip to main content
Download PDF
  • Author Correction
  • Open access
  • Published:

Author Correction: Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells

Genome Biology volume 26, Article number: 71 (2025) Cite this article

The Original Article was published on 24 April 2023

Correction: Genome Biol 24, 89 (2023)

https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13059-023–02928-7


Following publication of the original article [1], the authors identified an error in one of the guide RNA spacer sequences disclosed in Supplementary Table S3. The correct sequence for base editing mediated silencing of the CIITA is 5’−3’: CACTCACCTTAGCCTGAGCA, as originally described in Gaudelli et al. 2020 [2].

This error does not affect the main results and conclusions of the paper.

The Supplementary Table S3 of the original article [1] has been corrected.

References

  1. Glaser V, Flugel C, Kath J, et al. Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells. Genome Biol. 2023;24:89. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13059-023-02928-7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Gaudelli NM, Lam DK, Rees H, et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat Biotechnol. 2020;38:7. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41587-020-0491-6.

    Article  CAS  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. Berlin Center for Advanced Therapies (Becat), Charité – Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität Zu Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany

    Viktor Glaser, Christian Flugel, Jonas Kath, Weijie Du, Vanessa Drosdek, Clemens Franke, Maik Stein, Michael Schmueck-Henneresse, Hans-Dieter Volk, Petra Reinke & Dimitrios L. Wagner

  2. BIH Center for Regenerative Therapies (BCRT), Berlin Institute of Health at Charité – Universitätsmedizin Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany

    Viktor Glaser, Christian Flugel, Jonas Kath, Weijie Du, Vanessa Drosdek, Clemens Franke, Maik Stein, Michael Schmueck-Henneresse, Hans-Dieter Volk, Petra Reinke & Dimitrios L. Wagner

  3. Institute of Transfusion Medicine, Charité – Universitätsmedizin Berlin, corporate member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Campus Charité Mitte, Charitéplatz 1, Berlin, 10117, Germany

    Axel Pruß & Dimitrios L. Wagner

  4. Institute of Medical Immunology, Charité – Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität Zu Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany

    Hans-Dieter Volk & Dimitrios L. Wagner

  5. CheckImmune GmbH, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany

    Hans-Dieter Volk

Authors
  1. Viktor Glaser
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Christian Flugel
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Jonas Kath
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Weijie Du
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Vanessa Drosdek
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Clemens Franke
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Maik Stein
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Axel Pruß
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Michael Schmueck-Henneresse
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Hans-Dieter Volk
    View author publications

    You can also search for this author inPubMed Google Scholar

  11. Petra Reinke
    View author publications

    You can also search for this author inPubMed Google Scholar

  12. Dimitrios L. Wagner
    View author publications

    You can also search for this author inPubMed Google Scholar

Corresponding author

Correspondence to Dimitrios L. Wagner.

Supplementary Information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Glaser, V., Flugel, C., Kath, J. et al. Author Correction: Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells. Genome Biol 26, 71 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13059-025-03548-z

Download citation

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13059-025-03548-z

Genome Biology

ISSN: 1474-760X

Contact us